Microexon ID Sl_1:59422642-59422649:+
Species Solanum   Lycopersicum
Coordinates 1:59422642..59422649
Microexon Cluster ID Unclassified
Size 8
Sl_1:59422642-59422649:+ does not have available information here.
Transcript ID Solyc01g057170.3.1
Protein ID
Gene ID Solyc01g057170.3
Gene Name
Pfam domain motif Unknown
Motif E-value NA
Motif start NA
Motif end NA
Protein seq >Solyc01g057170.3.1
MPTETHVTLVFQLWRNHFNSA*
CDS seq >Solyc01g057170.3.1
ATGCCCACTGAAACTCATGTTACACTAGTTTTTCAGCTTTGGAGAAATCACTTCAATTCGGCATAA
Sl_1:59422642-59422649:+ does not have available information here.